ER alpha cDNA ORF Clone, Human, N-HA tag

1/1
Price:
Size:
Number:

ER alpha cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1788 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human estrogen receptor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(two restriction sites) (6kb + 1.18kb + 0.66kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ER alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ER alpha cDNA ORF Clone, Human, N-HA tag: Validated Images

ER alpha cDNA ORF Clone, Human, N-HA tag: Alternative Names

ER cDNA ORF Clone, Human; Era cDNA ORF Clone, Human; ESR cDNA ORF Clone, Human; ESRA cDNA ORF Clone, Human; ESTRR cDNA ORF Clone, Human; NR3A1 cDNA ORF Clone, Human

ER alpha Background Information

An ESR1 gene mutation, which encodes for the estrogen receptor (ER) protein, is one of the potential mechanisms of therapy resistance. The ESR1 mutations result in conformational changes in the ER leading to subsequent estrogen-independent transcriptional activity. The mutations within the estrogen receptor (ER) gene, ESR1, frequently occur in metastatic breast cancer and influence response to hormone therapy. Estrogen receptor alpha (ERalpha) is one of the estrogen hormone-activated transcription factors, which regulates a large number of genes and is involved in the mammary gland development. Expression of ERalpha is considered to be a good indicator for endocrine therapy and breast cancer survival. Loss of ERalpha in breast cancer patients indicates invasiveness and poor prognosis. ESR1 as a direct target of miR-31a-3p and suggest that miR-31a-3p likely contributes to development of estrogen independence, which leads to a more invasive phenotype of breast cancer. Polymorphisms of the estrogen receptor gene alpha (ESR1) are consistently been associated with bone mineral density (BMD) and fracture.
Full Name
estrogen receptor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait