Thrombin / Coagulation Factor II cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/2
Price:
Size:
Number:

Thrombin / Coagulation Factor II cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1869 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human coagulation factor II (thrombin) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.88kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Thrombin / Coagulation Factor II cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thrombin / Coagulation Factor II cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Thrombin / Coagulation Factor II cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

PT cDNA ORF Clone, Human; RPRGL2 cDNA ORF Clone, Human; THPH1 cDNA ORF Clone, Human

Thrombin / Coagulation Factor II Background Information

Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.
Full Name
coagulation factor II (thrombin)
References
  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait