Commande rapide

Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human F7 Informations sur les produits clonés de cDNA
Taille du ADNc:1335bp
Description du ADNc:Full length Clone DNA of Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) transcript variant 1 with C terminal Myc tag.
Synonyme du gène:SPCA
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG14137-ACGCHF270
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG14137-ACRCHF270
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG14137-CFCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG14137-CHCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG14137-CMCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG14137-CYCHF230
Humain Coagulation Factor VII transcript variant 1 Gène ADNc clone le vecteur de clonageHG14137-GCHF90
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG14137-NFCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG14137-NHCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG14137-NMCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG14137-NYCHF230
Humain Coagulation Factor VII transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG14137-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.

  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.
  • Size / Price
    Catalogue : HG14137-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.