Factor IX cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

Factor IX cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human coagulation factor IX with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.39kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Factor IX cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor IX cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

Factor IX cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

Coagulation factor 9 cDNA ORF Clone, Human; Coagulation factor IX cDNA ORF Clone, Human; FIX cDNA ORF Clone, Human; HEMB cDNA ORF Clone, Human; P19 cDNA ORF Clone, Human; PTC cDNA ORF Clone, Human; THPH8 cDNA ORF Clone, Human

Factor IX Background Information

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.
Full Name
coagulation factor IX
References
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait