FAM20C cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

FAM20C cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1800 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human family with sequence similarity 20, member C with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.8kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM20C cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM20C cDNA ORF Clone, Human, C-His tag: Validated Images

FAM20C cDNA ORF Clone, Human, C-His tag: Alternative Names

DMP-4 cDNA ORF Clone, Human; DMP4 cDNA ORF Clone, Human; GEF-CK cDNA ORF Clone, Human; RNS cDNA ORF Clone, Human

FAM20C Background Information

The Family with sequence similarity 2 member C (FAM2C) catalyzes the phosphorylation of secreted proteins, and participates in a variety of biological processes, including cell proliferation, migration, mineralization, and phosphate homeostasis. FAM2C is an evolutionarily reserved molecule highly expressed in mineralized tissues. Mutations in the Family with sequence similarity (FAM) 2 gene family are associated with mineralized tissue phenotypes in humans. Among these genes, FAM2A mutations are associated with Amelogenesis Imperfecta (AI) with gingival hyperplasia and nephrocalcinosis, while FAM2C mutations cause Raine syndrome, exhibiting bone and craniofacial/dental abnormalities. Raine syndrome is an autosomal recessive disorder caused by mutations in the FAM2C gene that is characterized by generalized osteosclerosis with periosteal new bone formation and distinctive craniofacial dysmorphism.
Full Name
family with sequence similarity 20, member C
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait