FGD2 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

FGD2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1968 bp
Description
Full length Clone DNA of Human FYVE, RhoGEF and PH domain containing 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGD2 cDNA ORF Clone, Human, N-HA tag: Alternative Names

ZFYVE4 cDNA ORF Clone, Human

FGD2 Background Information

Members of the Fgd (faciogenital dysplasia) gene family encode a group of critical guanine nucleotide exchange factors (GEFs), which, by specifically activating Cdc42, control cytoskeleton-dependent membrane rearrangements. In its first characterization, we find that FGD2 is expressed in antigen-presenting cells, including B lymphocytes, macrophages, and dendritic cells. In the B lymphocyte lineage, FGD2 levels change with developmental stage. In both mature splenic B cells and immature bone marrow B cells, FGD2 expression is suppressed upon activation through the B cell antigen receptor. FGD2 has a complex intracellular localization, with concentrations found in membrane ruffles and early endosomes. Although endosomal localization of FGD2 is dependent on a conserved FYVE domain, its C-terminal pleckstrin homology domain mediates recruitment to membrane ruffles. FGD2 overexpression promotes the activation of Cdc42 and leads to elevated JNK1 activity in a Cdc42- but not Rac1-dependent fashion. In several cases of familial glucocorticoid deficiency (FGD), referred to as FGD type 1, mutations have been described in the coding exon of the adrenocorticotropin receptor (melanonocortin receptor type 2, MC2R) gene. However, for the majority of cases (FGD type 2), no mutations were found in this gene.
Full Name
FYVE, RhoGEF and PH domain containing 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait