FGF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

FGF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Human fibroblast growth factor 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FGF4 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

HBGF-4 cDNA ORF Clone, Human; HST cDNA ORF Clone, Human; HST-1 cDNA ORF Clone, Human; HSTF1 cDNA ORF Clone, Human; K-FGF cDNA ORF Clone, Human; KFGF cDNA ORF Clone, Human

FGF4 Background Information

FGF (fibroblast growth factor) signalling is known to be required for many aspects of mesoderm formation and patterning during Xenopus development and has been implicated in regulating genes required for the specification of both blood and skeletal muscle lineages. Fibroblast growth factor 4 (FGF4) signaling induces differentiation from embryonic stem cells (ESCs) via the phosphorylation of downstream molecules such as mitogen-activated protein kinase/extracellular signal-related kinase (MEK) and extracellular signal-related kinase 1/2 (ERK1/2). Fibroblast Growth Factor 4 (FGF-4) could not only increase the proliferation of bone marrow mesenchymal stem cells (BMSCs), but also induce BMSCs into hepatocyte-like cells in vitro. FGF4 transduced BMSCs contributed to liver regeneration might by the transplanted microenvironment. The FGF4-bFGF BMSCs thus can enhance the survival of the transplanted cells, diminish myocardial fibrosis, promote myocardial angiogenesis, and improve cardiac functions.
Full Name
fibroblast growth factor 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait