KGF cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

KGF cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
579 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor 7 (keratinocyte growth factor) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 0.63kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KGF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KGF cDNA ORF Clone, Human, C-HA tag: Validated Images

KGF cDNA ORF Clone, Human, C-HA tag: Alternative Names

HBGF-7 cDNA ORF Clone, Human; KGF cDNA ORF Clone, Human

KGF Background Information

Fibroblast growth factor 7 (FGF7) is a member of the fibroblast growth factor (FGF) family of proteins. FGF7 plays an important role in regulating the proliferation, migration, and differentiation of cells. FGF7 is of stromal origin and produces a paracrine effect on epithelial cells. FGF7 is a mesenchyme-specific heparin-binding growth factor that binds FGF receptor 2 (FGFR2) to regulate numerous cellular and physiological processes. FGF7/FGFR2 promotes invasion and migration in human gastric cancer. FGF7 is specifically utilized as a paracrine factor during the process of differentiation of the epidermal layers in the regenerating scales and in particular for beta-cells differentiation. FGF7 over expression is associated with advanced clinical features in patients with upper tract and bladder urothelial carcinoma, justifying its potential prognostic value for urothelial carcinoma.
Full Name
fibroblast growth factor 7
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait