Commande rapide

Human FLRT1 ORF mammalian expression plasmid, N-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Human FLRT1 Informations sur les produits clonés de cDNA
Taille du ADNc:2025bp
Description du ADNc:Full length Clone DNA of Homo sapiens fibronectin leucine rich transmembrane protein 1 with N terminal His tag.
Synonyme du gène:MGC21624, FLRT1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT1 is expressed in kidney and brain, which is a target for tyrosine phosphorylation mediated by FGFR1 and implicate a non-receptor Src family kinase (SFK). All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. The phosphorylation state of FLRT1, which is itself FGFR1 dependent, may play a critical role in the potentiation of FGFR1 signalling and may also depend on a SFK-dependent phosphorylation mechanism acting via the FGFR. This is consistent with an 'in vivo' role for FLRT1 regulation of FGF signalling via SFKs. Furthermore, the phosphorylation-dependent futile cycle mechanism controlling FGFR1 signalling is concurrently crucial for regulation of FLRT1-mediated neurite outgrowth. FLRT1, FLRT2 and FLRT3 are members of the fibronectin leucine rich transmembrane protein (FLRT) family. They may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. FLRT3 shares 55% amino acid sequence identity with FLRT1.

  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Wheldon LM, et al. (2010) Critical role of FLRT1 phosphorylation in the interdependent regulation of FLRT1 function and FGF receptor signalling. PLoS One. 5(4): e10264.
  • Size / Price
    Catalogue : HG11389-NH
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.