Commande rapide

Humain VEGFR1/FLT-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human FLT1 Informations sur les produits clonés de cDNA
Taille du ADNc:2064bp
Description du ADNc:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 1 transcript variant 2 with C terminal Flag tag.
Synonyme du gène:FLT, FLT-1, VEGFR1, VEGFR-1
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain VEGFR1/FLT-1 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name

Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein kinase receptor FLT, Vascular permeability factor receptor and FLT1, is a single-pass type I membrane protein and secreted protein which belongs to the protein kinase superfamily, Tyr protein kinase family and CSF-1/PDGF receptor subfamily. VEGFR-1 / FLT1 contains seven Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. VEGFR-1 / FLT1 is expressed mostly in normal lung, but also in placenta, liver, kidney, heart and brain tissues. It is specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. VEGFR-1 / FLT1 is not expressed in tumor cell lines. VEGFR-1 / FLT1 is an essential receptor tyrosine kinase that regulates mammalian vascular development and embryogenesis. EGF-induced angiogenesis requires inverse regulation of VEGFR-1 and VEGFR-2 in tumor-associated endothelial cells. VEGFR-1 / FLT1 is a receptor for VEGF, VEGFB and PGF. It has a tyrosine-protein kinase activity. The VEGF-kinase ligand/receptor signaling system plays a key role in vascular development and regulation of vascular permeability.

Size / Price
Catalogue : HG13935-CF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.