After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Human FOXA3 natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Human FOXA3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC016024
Taille du ADNc:1053bp
Description du ADNc:Full length Clone DNA of Homo sapiens forkhead box A3.
Synonyme du gène:FKHH3, HNF3G, MGC10179, TCF3G, FOXA3
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalogue : HG14217-UT
Prix catalogue :   (Save )
Prix :      [How to order]
Disponibilité2-3 weeksInstructions d’expédition
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »