Commande rapide

Text Size:AAA

Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human FUOM Informations sur les produits clonés de cDNA
Taille du ADNc:465bp
Description du ADNc:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
Synonyme du gène:FUCU, FucM, C10orf125
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13974-ACGCHF270
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13974-ACRCHF270
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13974-ANGCHF270
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13974-ANRCHF270
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13974-CFCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13974-CHCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13974-CMCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13974-CYCHF230
Humain FUOM / fucose mutarotase / FucM Gène ADNc clone le vecteur de clonageHG13974-GCHF90
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13974-NFCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13974-NHCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13974-NMCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13974-NYCHF230
Humain FUOM / fucose mutarotase / FucM expression plasmide de Gène l'ADNc ORF cloneHG13974-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Catalogue : HG13974-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.