Factor VII cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/2
Price:
Size:
Number:

Factor VII cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 C/T, 1236 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human coagulation factor VII (serum prothrombin conversion accelerator) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI (6kb + 1.36kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Factor VII cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor VII cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Factor VII cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

Coagulation factor 7 cDNA ORF Clone, Human; Coagulation factor VII cDNA ORF Clone, Human; SPCA cDNA ORF Clone, Human

Factor VII Background Information

Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.
Full Name
coagulation factor VII (serum prothrombin conversion accelerator)
References
  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.

Factor VII cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait