Frizzled 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Frizzled 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1746 bp
Description
Full length Clone DNA of Human frizzled family receptor 10 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Frizzled 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CD350 cDNA ORF Clone, Human; FZ-10 cDNA ORF Clone, Human; Fz10 cDNA ORF Clone, Human; FzE7 cDNA ORF Clone, Human; hFz10 cDNA ORF Clone, Human

Frizzled 10 Background Information

Frizzled-1, also known as Fz-1, CD35 and FZD1, is a multi-pass membrane protein which belongs to theG-protein coupled receptor Fz/Smo family. Frizzled-1 / FZD1 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-1 / FZD1 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-1 / FZD1 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.
Full Name
frizzled class receptor 10
References
  • Kwon H.S., et al.,(2009), Myocilin is a modulator of Wnt signaling. Mol. Cell. Biol. 29:2139-2154.
  • The MGC Project Team, et al., (2004), The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).Genome Res. 14:2121-2127.
  • Tanaka S., et al.,(1998), A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals.Proc. Natl. Acad. Sci. U.S.A. 95:10164-10169.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait