FZR1/Cdh1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

FZR1/Cdh1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fizzy/cell division cycle 20 related 1 (Drosophila) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.52kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FZR1/Cdh1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FZR1/Cdh1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

FZR1/Cdh1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CDC20C cDNA ORF Clone, Human; CDH1 cDNA ORF Clone, Human; FZR cDNA ORF Clone, Human; FZR2 cDNA ORF Clone, Human; HCDH cDNA ORF Clone, Human; HCDH1 cDNA ORF Clone, Human

FZR1/Cdh1 Background Information

Full Name
fizzy/cell division cycle 20 related 1 (Drosophila)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait