Commande rapide

Humain GABRA4 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain GABRA4 Informations sur les produits clonés de cDNA
Taille du ADNc:1665bp
Description du ADNc:Full length Clone DNA of Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 with N terminal His tag.
Synonyme du gène:GABRA4
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with GABRA4 qPCR primers for gene expression analysis, HP103486 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalogue : HG14855-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.