After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain GALK1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human GALK1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000154.1
Taille du ADNc:1179bp
Description du ADNc:Full length Clone DNA of Homo sapiens galactokinase 1 with N terminal His tag.
Synonyme du gène:GK1, GALK, GALK1
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

Références
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • Size / Price
    Catalogue : HG11383-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »