GALNT2 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

GALNT2 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1716 bp
Description
Full length Clone DNA of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GALNT2 cDNA ORF Clone, Human, N-HA tag: Alternative Names

GalNAc-T2 cDNA ORF Clone, Human

GALNT2 Background Information

GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. GALNT2 may play a role in lipid metabolism. It catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. GALNT2 has a broad spectrum of substrates for peptides such as EA2, Muc5AC, Muc1a, Muc1b.
Full Name
polypeptide N-acetylgalactosaminyltransferase 2
References
  • Bennett EP. et al., 1998, Glycobiology. 8 (6): 547-55.
  • White T. et al., 1995, J Biol Chem. 270 (41): 24156-65.
  • Bennett EP. et al., 1996, J Biol Chem. 271 (29): 17006-12.
  • Holleboom AG. et al., 2011, Cell Metab. 14 (6): 811-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait