GBA3 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

GBA3 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1410 bp
Description
Full length Clone DNA of Human glucosidase, beta, acid 3 (cytosolic) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GBA3 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

CBG cDNA ORF Clone, Human; CBGL1 cDNA ORF Clone, Human; GBA3 cDNA ORF Clone, Human; GLUC cDNA ORF Clone, Human; KLrP cDNA ORF Clone, Human; MGC104276 cDNA ORF Clone, Human; MGC126878 cDNA ORF Clone, Human

GBA3 Background Information

Cytosolic beta-glucosidase, also known as Cytosolic beta-glucosidase-like protein 1, GBA3, CBG and CBGL1 is a cytoplasm protein which belongs to theglycosyl hydrolase 1 family and Klotho subfamily. GBA3 / CBGL1 is a glycosidase probably involved in the intestinal absorption and metabolism of dietary flavonoid glycosides. GBA3 / CBGL1 is present in small intestine (at protein level). GBA3 / CBGL1 is expressed in liver, small intestine, colon, spleen and kidney. GBA3 / CBGL1 is down-regulated in renal cell carcinomas and hepatocellular carcinomas. GBA3 / CBGL1 is able to hydrolyze a broad variety of glycosides including phytoestrogens, flavonols, flavones, flavanones and cyanogens. GBA3 / CBGL1 possesses beta-glycosylceramidase activity and may be involved in a nonlysosomal catabolic pathway of glycosylceramide.
Full Name
glucosidase, beta, acid 3 (gene/pseudogene)
References
  • Yahata K., et al.,(2000), Molecular cloning and expression of a novel klotho-related protein. J. Mol. Med. 78:389-394.
  • de Graaf M., et al., (2001), Cloning and characterization of human liver cytosolic beta-glycosidase.Biochem. J. 356:907-910.
  • Berrin J.-G., et al.,(2002), Functional expression of human liver cytosolic beta-glucosidase in Pichia pastoris. Insights into its role in the metabolism of dietary glucosides.Eur. J. Biochem. 269:249-258.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait