After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain GFAP expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human GFAP Informations sur les produits clonés de cDNA
Taille du ADNc:1299bp
Description du ADNc:Full length Clone DNA of Homo sapiens glial fibrillary acidic protein with C terminal Myc tag.
Synonyme du gène:FLJ42474, FLJ45472, GFAP
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.

  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • Size / Price
    Catalogue : HG12167-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.