After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Gastric intrinsic factor / GIF expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human GIF Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC037958
Taille du ADNc:1254bp
Description du ADNc:Full length Clone DNA of Homo sapiens gastric intrinsic factor (vitamin B synthesis) with C terminal Myc tag.
Synonyme du gène:IF, INF, IFMH, TCN3, GIF
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain Gastric intrinsic factor / GIF expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Product nameProduct name
Fond

Gastric intrinsic factor, also known as GIF, belongs to the of the cobalamin transport protein family. It is a glycoprotein produced by the parietal cells of the stomach. Gastric intrinsic factor plays a key role in the absorption of vitamin B12 on in the small intestine. Vitamin B12 bounds to haptocorrin after entry into the stomach. The resulting complex enters the duodenum, where pancreatic enzymes digest haptocorrin. In the less acidic environment of the small intestine, B12 can then bind to gastric intrinsic factor. This new complex travels to the ileum, where special epithelial cells endocytose them. Inside the cell, B12 dissociates once again and binds to another protein, transcobalamin II. The new complex can exit the epithelial cells to enter the liver.

Références
  • Gerdin AK. (2010) The Sanger Mouse Genetics Programme: high throughput characterisation of knockout mice. Acta Opthalmologica. 88:925-7.
  • AU - Berlin H, et al. (1968) ORAL TREATMENT OF PERNICIOUS ANEMIA WITH HIGH DOSES OF VITAMIN B12 WITHOUT INTRINSIC FACTOR. Acta Medica Scandinavica. 184(1-6):247-58.
  • Hewitt JE, et al. (1991) Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics. 10(2):432-40.
  • Size / Price
    Catalogue : HG13544-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »