GLB1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

GLB1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2034 bp
Description
Full length Clone DNA of Human galactosidase, beta 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GLB1 cDNA ORF Clone, Human, untagged: Alternative Names

EBP cDNA ORF Clone, Human; ELNR1 cDNA ORF Clone, Human; MPS4B cDNA ORF Clone, Human

GLB1 Background Information

Full Name
galactosidase, beta 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait