GNRH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

GNRH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
363 bp
Description
Full length Clone DNA of Human gonadotropin-releasing hormone 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GNRH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

GnRH-II cDNA ORF Clone, Human; GNRH2 cDNA ORF Clone, Human; LH-RHII cDNA ORF Clone, Human

GNRH2 Background Information

the second mammalian isoform (GNRH2) is an ineffective stimulant of gonadotropin release. Given that pigs lack testicular GNRHR1, these data may indicate that GNRH2 and its receptor are involved in autocrine or paracrine regulation of testosterone secretion.
Full Name
gonadotropin releasing hormone 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait