Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag

Cat: HG14196-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Aspartate Aminotransferase Reagents

CRO Services

Product recommended


All Aspartate Aminotransferase Reagents

Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1242 bp
Description
Full length Clone DNA of Human glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aspartate Aminotransferase cDNA ORF Clone, Human, N-HA tag Alternative Names

ASTQTL1 cDNA ORF Clone, Human;cAspAT cDNA ORF Clone, Human;cCAT cDNA ORF Clone, Human;GIG18 cDNA ORF Clone, Human

Aspartate Aminotransferase Background Information

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

Full Name
glutamic-oxaloacetic transaminase 1, soluble
References
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Aspartate Aminotransferase cDNA ORF Clone in Cloning Vector, Cynomolgus CG90649-G
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, untagged CG90649-UT
    Aspartate Aminotransferase Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90649-ACGLN
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90649-ACG
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90649-ANG
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90649-ACR
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90649-ANR
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90649-CF
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90649-NF
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-His tag CG90649-CH
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-His tag CG90649-NH
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-HA tag CG90649-CY
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-HA tag CG90649-NY
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, C-Myc tag CG90649-CM
    Aspartate Aminotransferase cDNA ORF Clone, Cynomolgus, N-Myc tag CG90649-NM

    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Aspartate Aminotransferase cDNA ORF Clone in Cloning Vector, Rabbit TG65026-G
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, untagged TG65026-UT
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65026-ACG
    Aspartate Aminotransferase Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65026-ACGLN
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65026-ANG
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65026-ACR
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65026-ANR
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65026-CF
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65026-NF
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-His tag TG65026-CH
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-His tag TG65026-NH
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-HA tag TG65026-CY
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-HA tag TG65026-NY
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, C-Myc tag TG65026-CM
    Aspartate Aminotransferase cDNA ORF Clone, Rabbit, N-Myc tag TG65026-NM

    Aspartate Aminotransferase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Aspartate Aminotransferase cDNA ORF Clone in Cloning Vector, Rat RG80493-U
    Aspartate Aminotransferase cDNA ORF Clone, Rat, untagged RG80493-UT
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80493-ACG
    Aspartate Aminotransferase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80493-ACGLN
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80493-ANG
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80493-ACR
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80493-ANR
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80493-CF
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80493-NF
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-His tag RG80493-CH
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-His tag RG80493-NH
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-HA tag RG80493-CY
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-HA tag RG80493-NY
    Aspartate Aminotransferase cDNA ORF Clone, Rat, C-Myc tag RG80493-CM
    Aspartate Aminotransferase cDNA ORF Clone, Rat, N-Myc tag RG80493-NM
    Aspartate Aminotransferase qPCR Primer Pairs, Rat RP300457

    Aspartate Aminotransferase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aspartate Aminotransferase cDNA ORF Clone in Cloning Vector, Mouse MG52261-G
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, untagged MG52261-UT
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52261-ACG
    Aspartate Aminotransferase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52261-ACGLN
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52261-ANG
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52261-ACR
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52261-ANR
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52261-CF
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52261-NF
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-His tag MG52261-CH
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-His tag MG52261-NH
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-HA tag MG52261-CY
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-HA tag MG52261-NY
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, C-Myc tag MG52261-CM
    Aspartate Aminotransferase cDNA ORF Clone, Mouse, N-Myc tag MG52261-NM
    Aspartate Aminotransferase qPCR Primer Pairs, Mouse MP202134

    Aspartate Aminotransferase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aspartate Aminotransferase cDNA ORF Clone in Cloning Vector, Human HG14196-G
    Aspartate Aminotransferase cDNA ORF Clone, Human, untagged HG14196-UT
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-GFPSpark® tag HG14196-ACG
    Aspartate Aminotransferase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14196-ACGLN
    Aspartate Aminotransferase cDNA ORF Clone, Human, N-GFPSpark® tag HG14196-ANG
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-OFPSpark® tag HG14196-ACR
    Aspartate Aminotransferase cDNA ORF Clone, Human, N-OFPSpark® tag HG14196-ANR
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14196-CF
    Aspartate Aminotransferase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14196-NF
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-His tag HG14196-CH
    Aspartate Aminotransferase cDNA ORF Clone, Human, N-His tag HG14196-NH
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-HA tag HG14196-CY
    Aspartate Aminotransferase cDNA ORF Clone, Human, C-Myc tag HG14196-CM
    Aspartate Aminotransferase cDNA ORF Clone, Human, N-Myc tag HG14196-NM
    Aspartate Aminotransferase qPCR Primer Pairs, Human HP102847
    info info
    添加购物车成功! 添加购物车失败!