GPR114 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

GPR114 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1587 bp
Description
Full length Clone DNA of Human G protein-coupled receptor 114 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPR114 cDNA ORF Clone, Human, N-HA tag: Alternative Names

GPR114 cDNA ORF Clone, Human; PGR27 cDNA ORF Clone, Human

GPR114 Background Information

GPR114 belongs to the G-protein coupled receptor 2 family. Members of this family share a common molecular architecture which consists of seven transmembrane domains, three extracellular loops, three intracellular loops, an amino-terminal extracellular domain and an intracellular carboxyl terminus. It is thought that light acts as the activating stimulus of a G-protein-coupled receptor (GPCR). GPCRs are expected to have molecular function (G-protein coupled receptor activity) and to localize in various compartments (endoplasmic reticulum membrane, plasma membrane, integral to membrane). Family B of the GPCRs is a small but structurally and functionally diverse group of proteins that includes receptors for polypeptide hormones, molecules thought to mediate intercellular interactions at the plasma membrane and a group of Drosophila proteins that regulate stress responses and longevity. GPR114 contains 1 GPS domain. GPR114 gene has been proposed to participate in processes (G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway).
References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Bjarnadttir TK, et al. (2005) The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. Genomics. 84(1):23-33.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait