GRK5 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

GRK5 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1773 bp
Description
Full length Clone DNA of Human G protein-coupled receptor kinase 5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GRK5 cDNA ORF Clone, Human, C-HA tag: Alternative Names

GPRK5 cDNA ORF Clone, Human

GRK5 Background Information

G protein-coupled receptor kinase 5, also known as G protein-coupled receptor kinase GRK5 and GRK5, is a member of the protein kinase superfamily, AGC Ser/Thr protein kinase family and GPRK subfamily. GRKs specifically phosphorylate agonist-occupied G protein-coupled receptors at the inner surface of the plasma membrane (PM), leading to receptor desensitization. GRKs utilize a variety of mechanisms to bind tightly, and sometimes reversibly, to cellular membranes. GRKs play an important role in mediating agonist-specific desensitization of numerous G protein-coupled receptors.
GRK5 contains oneAGC-kinase C-terminal domain, oneprotein kinase domain and oneRGS domain. GRK5 specifically phosphorylates the activated forms of G protein-coupled receptors. Phospholipid-stimulated autophosphorylation may represent a novel mechanism for membrane association and regulation of GRK5 activity. GRK5 deficiency significantly exaggerates microgliosis and astrogliosis in the presence of an inflammatory initiator, such as the excess fibrillar Abeta and the subsequent active inflammatory reactions. GRK5 deficiency has been linked to early Alzheimer's disease in humans and mouse models of the disease.
Full Name
G protein-coupled receptor kinase 5
References
  • Kunapuli,P. et al., 1994, J Biol Chem. 269 (14):10209-12.
  • Millman,E.E. et al., 2004, Br J Pharmacol  141 (2):277-84.
  • Thiyagarajan,M.M. et al., 2004, J Biol Chem  279 (17):17989-95.
  • Suo,Z. et al., 2007,Neurobiol Aging. 28 (12):1873-88.
  • Li,L. et al., 2008,J Neuroinflammation. 5 :24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait