GRPEL2 cDNA ORF Clone, Human, N-HA tag

Cat: HG15355-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GRPEL2 Reagents

CRO Services

Product recommended


All GRPEL2 Reagents

GRPEL2 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Human GrpE-like 2, mitochondrial (E. coli) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRPEL2 cDNA ORF Clone, Human, N-HA tag Alternative Names

Mt-GrpE#2 cDNA ORF Clone, Human

GRPEL2 Background Information

Full Name
GrpE-like 2, mitochondrial (E. coli)

GRPEL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRPEL2 cDNA ORF Clone in Cloning Vector, Rat RG8A2088-U
GRPEL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A2088-ACGLN

GRPEL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRPEL2 cDNA ORF Clone in Cloning Vector, Mouse MG51998-G
GRPEL2 cDNA ORF Clone, Mouse, untagged MG51998-UT
GRPEL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51998-ACG
GRPEL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51998-ACGLN
GRPEL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51998-ACR
GRPEL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51998-CF
GRPEL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51998-NF
GRPEL2 cDNA ORF Clone, Mouse, C-His tag MG51998-CH
GRPEL2 cDNA ORF Clone, Mouse, N-His tag MG51998-NH
GRPEL2 cDNA ORF Clone, Mouse, C-HA tag MG51998-CY
GRPEL2 cDNA ORF Clone, Mouse, N-HA tag MG51998-NY
GRPEL2 cDNA ORF Clone, Mouse, C-Myc tag MG51998-CM
GRPEL2 cDNA ORF Clone, Mouse, N-Myc tag MG51998-NM
GRPEL2 qPCR Primer Pairs, Mouse MP201871

GRPEL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRPEL2 cDNA ORF Clone in Cloning Vector, Human HG15355-G
GRPEL2 cDNA ORF Clone, Human, untagged HG15355-UT
GRPEL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15355-ACGLN
GRPEL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15355-ACG
GRPEL2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15355-ANG
GRPEL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15355-ACR
GRPEL2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15355-ANR
GRPEL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15355-CF
GRPEL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15355-NF
GRPEL2 cDNA ORF Clone, Human, C-His tag HG15355-CH
GRPEL2 cDNA ORF Clone, Human, N-His tag HG15355-NH
GRPEL2 cDNA ORF Clone, Human, C-HA tag HG15355-CY
GRPEL2 cDNA ORF Clone, Human, C-Myc tag HG15355-CM
GRPEL2 cDNA ORF Clone, Human, N-Myc tag HG15355-NM
GRPEL2 qPCR Primer Pairs, Human HP103979
info info
添加购物车成功! 添加购物车失败!