Commande rapide

Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human GSTM2 Informations sur les produits clonés de cDNA
Taille du ADNc:657bp
Description du ADNc:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
Synonyme du gène:GST4
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12042-ACGCHF270
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12042-ACRCHF270
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12042-ANGCHF270
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12042-ANRCHF270
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12042-CFCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12042-CHCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12042-CMCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12042-CYCHF230
Humain GSTM2 transcript variant 1 Gène ADNc clone le vecteur de clonageHG12042-GCHF90
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12042-NFCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12042-NHCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12042-NMCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12042-NYCHF230
Humain GSTM2 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG12042-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Catalogue : HG12042-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.