After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain GSTZ1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human GSTZ1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC001453
Taille du ADNc:651bp
Description du ADNc:Full length Clone DNA of Homo sapiens glutathione S-transferase zeta 1.
Synonyme du gène:GSTZ1-1, MAAI, MAI, MGC2029, GSTZ1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

Références
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Size / Price
    Catalogue : HG14237-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »