Galectin-1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Galectin-1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
408 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.41kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-1 cDNA ORF Clone, Human, untagged: Alternative Names

GAL1 cDNA ORF Clone, Human; Galectin-1 cDNA ORF Clone, Human; GBP cDNA ORF Clone, Human

Galectin-1 Background Information

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.
Full Name
lectin, galactoside-binding, soluble, 1
References
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait