LGALS3BP cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

LGALS3BP cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 3 binding protein.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.76kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LGALS3BP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LGALS3BP cDNA ORF Clone, Human, untagged: Validated Images

LGALS3BP cDNA ORF Clone, Human, untagged: Alternative Names

90K cDNA ORF Clone, Human; BTBD17B cDNA ORF Clone, Human; CyCAP cDNA ORF Clone, Human; gp90 cDNA ORF Clone, Human; M2BP cDNA ORF Clone, Human; MAC-2-BP cDNA ORF Clone, Human; TANGO10B cDNA ORF Clone, Human

LGALS3BP Background Information

Lectin galactoside-binding soluble 3 binding protein (LGALS3BP, also called Mac-2 binding protein) is a heavily glycosylated secreted molecule that has been shown previously to be up-regulated in many cancers and has been implicated in tumor metastatic processes, as well as in other cell adhesion and immune functions. Galectin-3 (Gal-3), coding by LGALS3BP gene, is a protein of the lectin family that has been associated with neoplastic processes and seems to play an important role in a variety of cell biological processes.
Full Name
lectin, galactoside-binding, soluble, 3 binding protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait