Galectin 8 / LGALS8 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

Galectin 8 / LGALS8 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 8, transcript variant 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Galectin 8 / LGALS8 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

Gal-8 cDNA ORF Clone, Human; PCTA-1 cDNA ORF Clone, Human; PCTA1 cDNA ORF Clone, Human; Po66-CBP cDNA ORF Clone, Human

Galectin 8 / LGALS8 Background Information

Full Name
lectin, galactoside-binding, soluble, 8
References
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait