H2AFY cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

H2AFY cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Human H2A histone family, member Y with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

H2AFY cDNA ORF Clone, Human, C-Myc tag: Alternative Names

H2A.y cDNA ORF Clone, Human; H2A/y cDNA ORF Clone, Human; H2AF12M cDNA ORF Clone, Human; H2AFJ cDNA ORF Clone, Human; MACROH2A1.1 cDNA ORF Clone, Human; macroH2A1.2 cDNA ORF Clone, Human; mH2A1 cDNA ORF Clone, Human

H2AFY Background Information

H2AFY as a potential biomarker associated with disease activity and pharmacodynamic response that may become useful for enabling disease-modifying therapeutics for Huntington disease (HD).
Full Name
H2A histone family, member Y
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait