After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain HAO1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human HAO1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_017545.2
Taille du ADNc:1113bp
Description du ADNc:Full length Clone DNA of Homo sapiens hydroxyacid oxidase (glycolate oxidase) 1 with C terminal HA tag.
Synonyme du gène:GOX, GOX1, HAOX1, MGC142225, MGC142227, HAO1
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Hydroxyacid oxidase 1, also known as Glycolate oxidase, HAO1 and GOX1, is a member of the FMN-dependent alpha-hydroxy acid dehydrogenase family. HAO1 / GOX1 has 2-hydroxyacid oxidase activity. It is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 / GOX1 is a liver-specific peroxisomal enzyme that oxidizes glycolate to glyoxylate with concomitant production of H2O2. In Hao1 messenger RNA (mRNA), an iron-responsive element (IRE) homologous to the sequence recognized by iron regulatory proteins (IRP), key regulators of iron homeostasis, is present. Mammalian HAO1 / GOX1 is a peroxisomal protein and that the C-terminal sequence SKI acts as the targeting signal. Down-regulation of HAO1 / GOX1 expression during oxidative stress may provide a mechanism to prevent excessive H2O2 formation in liver peroxisomes and may represent the prototype of a poorly recognized but potentially relevant response to oxidative injury involving down-regulation of ROS-producing enzymes.

Références
  • Jones J.M.et al., 2000, J. Biol. Chem. 275:12590-7.
  • Recalcati,S. et al., 2001, J Cell Sci. 114 (Pt 9):1625-9.
  • Recalcati,S. et al., 2003, Hepatology. 38 (5):1159-66.
  • Murray M.S.et al., 2008, Biochemistry 47:2439-49.
  • Bourhis J.M.et al., 2009, Acta Crystallogr. F 65:1246-53.
  • Size / Price
    Catalogue : HG12076-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »