HEPACAM cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

HEPACAM cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1251 bp
Description
Full length Clone DNA of Human hepatic and glial cell adhesion molecule with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HEPACAM cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

GlialCAM cDNA ORF Clone, Human; HEPACAM cDNA ORF Clone, Human; MLC2A cDNA ORF Clone, Human; MLC2B cDNA ORF Clone, Human

HEPACAM Background Information

Full Name
hepatic and glial cell adhesion molecule
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait