HIST1H2AJ cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

HIST1H2AJ cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Human histone cluster 1, H2aj with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HIST1H2AJ cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

dJ160A22.4 cDNA ORF Clone, Human; H2A/E cDNA ORF Clone, Human; H2AFE cDNA ORF Clone, Human

HIST1H2AJ Background Information

Full Name
histone cluster 1, H2aj
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait