HNMT cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

HNMT cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human histamine N-methyltransferase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HNMT cDNA ORF Clone, Human, C-His tag: Alternative Names

HMT cDNA ORF Clone, Human; HNMT-S1 cDNA ORF Clone, Human; HNMT-S2 cDNA ORF Clone, Human

HNMT Background Information

Histamine-N-methyltransferase (HNMT), the major enzyme for the metabolism of histamine in rat brain, is potently inhibited by 9-amino-1,2,3,4-tetrahydroacridine (tacrine). Methylation is an important pathway in the biotransformation of many drugs, neurotransmitters, and xenobiotic compounds. Histamine N-methyltransferase (HNMT) catalyzes the N tau-methylation of histamine and structurally related compounds. Histamine N-methyltransferase (HNMT) is believed to be the sole pathway for termination of the neurotransmitter action of histamine in mammalian brain. That highlight the importance of inclusion of HNMT for genetic testing of individuals presenting with intellectual disability.
Full Name
histamine N-methyltransferase
References
  • Yan L., et al., 2000, Pharmacogenetics 10:261-266.
  • Horton J.R., et al., 2001, Structure 9:837-849.
  • Hillier L.W., et al., 2005, Nature 434:724-731.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait