Commande rapide

Text Size:AAA

Humain HNRNP R / HNRNPR expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human HNRNPR Informations sur les produits clonés de cDNA
Taille du ADNc:1911bp
Description du ADNc:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein R with N terminal Myc tag.
Synonyme du gène:FLJ25714, HNRPR, hnRNP R, hnRNP-R, HNRNPR
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain HNRNP R / HNRNPR expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Product nameProduct name

HNRNP R, also known as HNRNPR, is a RNA binding protein. HNRNP R gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). HnRNPs complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. HNRNP R has three repeats of quasi-RRM domains that bind to RNAs and also contains a nuclear localization motif.

  • Rossoll, et al. (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons?. Hum Mol Genet. 11 (1):93-105.
  • Mourelatos, Z, et al. (2001) SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J. 20(19):5443-52.
  • Hassfeld W, et al. (1998) Molecular definition of heterogeneous nuclear ribonucleoprotein R (hnRNP R) using autoimmune antibody: immunological relationship with hnRNP P. Nucleic Acids Res. 26(2):439-45.
  • Size / Price
    Catalogue : HG14309-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.