After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain HRAS expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human HRAS Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001130442.1
Taille du ADNc:570bp
Description du ADNc:Full length Clone DNA of Homo sapiens v-Ha-ras Harvey rat sarcoma viral oncogene homolog with N terminal Flag tag.
Synonyme du gène:CTLO, HAMSV, HRAS1, K-RAS, N-RAS, RASH1, C-H-RAS, H-RASIDX, C-BAS/HAS, C-HA-RAS1, HRAS
Espèces:Human
Vecteur:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-HRAS
Site de restriction:KpnI + XbaI (6kb + 0.62kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human HRAS Gene Plasmid Map
Human HRAS natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

HRas, also known as HRAS, belongs to the small GTPase superfamily, Ras family and is widely expressed. It functions in signal transduction pathways. HRas can bind GTP and GDP, and they have intrinsic GTPase activity. It undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Defects in HRAS are the cause of faciocutaneoskeletal syndrome (FCSS). FCSS is arare condition characterized by prenatally increased growth, postnatal growth deficiency, mental retardation, distinctive facial appearance, cardiovascular abnormalities, tumor predisposition, skin and musculoskeletal abnormalities. Defects in HRAS also can cause congenital myopathy with excess of muscle spindles. HRAS deficiency may be a cause of susceptibility to Hurthle cell thyroid carcinoma. It has been shown that defects in HRAS can cause susceptibility to bladder cancer which is a malignancy originating in tissues of the urinary bladder. It often presents with multiple tumors appearing at different times and at different sites in the bladder. Most bladder cancers are transitional cell carcinomas. They begin in cells that normally make up the inner lining of the bladder. Other types of bladder cancer include squamous cell carcinoma (cancer that begins in thin, flat cells) and adenocarcinoma (cancer that begins in cells that make and release mucus and other fluids). Bladder cancer is a complex disorder with both genetic and environmental influences. Defects in HRAS are the cause of oral squamous cell carcinoma.

Références
  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Gripp KW, et al. (2011) Molecular confirmation of HRAS p.G12S in siblings with Costello syndrome. Am J Med Genet A. 155A(9):2263-8.
  • Na KY, et al. (2012) Allelic loss of susceptibility loci and the occurrence of BRAF and RAS mutations in patients with familial non-medullary thyroid cancer. J Surg Oncol. 105(1):10-4.
  • Membrino A, et al. (2011) G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy. PLoS One. 6(9):e24421.
  • Size / Price
    Catalogue : HG12059-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human HRAS natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »