After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain HSPB8/Cryac expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human HSPB8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_014365.2
Taille du ADNc:591bp
Description du ADNc:Full length Clone DNA of Homo sapiens heat shock 22kDa protein 8.
Synonyme du gène:H11, HMN2, CMT2L, DHMN2, E2IG1, HMN2A, HSP22, HSPB8
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-HSPB8
Site de restriction:KpnI + XbaI (6.1kb + 0.59kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPB8 Gene Plasmid Map
Human HSPB8 / Cryac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain HSPB8/Cryac expression plasmide de Gène l'ADNc ORF clone on other vectors
Product nameProduct name
Size / Price
Catalogue : HG10666-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »