Commande rapide

Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ICAM2 Informations sur les produits clonés de cDNA
Taille du ADNc:828bp
Description du ADNc:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 2 (ICAM2), transcript variant 5 with C terminal Flag tag.
Synonyme du gène:CD102
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10332-ACGCHF270
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10332-ACRCHF270
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10332-CFCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10332-CHCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10332-CMCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10332-CYCHF230
Humain ICAM-2/CD102 transcript variant 5 Gène ADNc clone le vecteur de clonageHG10332-MCHF90
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10332-M-FCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10332-NFCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10332-NHCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10332-NMCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10332-NYCHF230
Humain ICAM-2/CD102 transcript variant 5 expression plasmide de Gène l'ADNc ORF cloneHG10332-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • Size / Price
    Catalogue : HG10332-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.