Commande rapide

Humain Insulysin/insulin-degrading enzyme expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

  • Human Insulysin/insulin-degrading enzyme Gene Plasmid Map 15908
Fiche techniqueCommentairesProduits apparentésProtocoles
Humain IDE Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC096336
Taille du ADNc:3105 bp
Description du ADNc:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Synonyme du gène:INSULYSIN
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:pCMV3-His-IDE
Site de restriction:KpnI(two restriction sites) + XbaI(6kb+3.06kb+0.06kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDE qPCR primers for gene expression analysis, HP104565 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain Insulysin/insulin-degrading enzyme expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »