Commande rapide

Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain IDO1 Informations sur les produits clonés de cDNA
Taille du ADNc:1212bp
Description du ADNc:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1 with C terminal Flag tag.
Synonyme du gène:IDO, INDO, IDO1
Site de restriction:KpnI + XbaI (6kb + 1.25kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
( We provide with IDO1 qPCR primers for gene expression analysis, HP101496 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Humain IDO1 Gene Plasmid Map
Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
Humain IDO1 Gene Expression validated Image
Human IDO1 ORF mammalian expression plasmid, C-Flag tag
[Cliquer pour agrandir l’image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11650-ACGCHF270
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11650-ACRCHF270
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11650-ANGCHF270
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11650-ANRCHF270
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11650-CFCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11650-CHCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11650-CMCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11650-CYCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase Gène ADNc clone le vecteur de clonageHG11650-MCHF90
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11650-NFCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11650-NHCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11650-NMCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11650-NYCHF230
Humain IDO1/Indoleamine 2,3‑dioxygenase expression plasmide de Gène l'ADNc ORF cloneHG11650-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.
  • Size / Price
    Catalogue : HG11650-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
    • Human IDO1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human IDO1 ORF mammalian expression plasmid, C-Flag tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.