After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IDS Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000202.5
Taille du ADNc:1653bp
Description du ADNc:Full length Clone DNA of Homo sapiens iduronate 2-sulfatase, transcript variant 1 with C terminal Flag tag.
Synonyme du gène:MPS2, SIDS
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:pCMV3-IDS-Flag
Site de restriction:KpnI + XbaI (6kb + 1.69kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human IDS Gene Plasmid Map
Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10337-ACGCHF294
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10337-ACRCHF294
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10337-CFCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10337-CHCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10337-CMCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10337-CYCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 Gène ADNc clone le vecteur de clonageHG10337-MCHF90
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10337-NFCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10337-NHCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10337-NMCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10337-NYCHF258
Humain Iduronate 2-Sulfatase / IDS transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10337-UTCHF258
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Size / Price
Catalogue : HG10337-CF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Human IDS / MPS2 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »