Commande rapide

Humain IFITM3 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IFITM3 Informations sur les produits clonés de cDNA
Taille du ADNc:447 bp
Description du ADNc:Full length Clone DNA of Homo sapiens interferon induced transmembrane protein 3 with C terminal Myc tag.
Synonyme du gène:1-8U,DSPA2b,IP15
Site de restriction:KpnI + XbaI(6kb+0.45kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 42T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.

  • Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.
  • Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.
  • Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.
  • Size / Price
    Catalogue : HG14141-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.