IGFBP7 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

IGFBP7 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
894 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human insulin-like growth factor binding protein 7 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.89kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IGFBP7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP7 cDNA ORF Clone, Human, C-His tag: Validated Images

IGFBP7 cDNA ORF Clone, Human, C-His tag: Alternative Names

AGM cDNA ORF Clone, Human; FSTL2 cDNA ORF Clone, Human; IBP-7 cDNA ORF Clone, Human; IGFBP-7 cDNA ORF Clone, Human; IGFBP-7v cDNA ORF Clone, Human; IGFBPRP1 cDNA ORF Clone, Human; MAC25 cDNA ORF Clone, Human; PSF cDNA ORF Clone, Human; RAMSVPS cDNA ORF Clone, Human; TAF cDNA ORF Clone, Human

IGFBP7 Background Information

Insulin like growth factor binding protein 7 (IGFBP7) is a member of the IGFBP family. It has been identified in colorectal adenocarcinoma (CRC) cell lines. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGFBP7 could inhibit cell growth, decrease soft agar colony formation activity and induce apoptosis in RKO and SW62 cells. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.
Full Name
insulin-like growth factor binding protein 7
References
  • Oh Y, et al. (1996) Synthesis and characterization of insulin-like growth factor-binding protein (IGFBP)-7. Recombinant human mac25 protein specifically binds IGF-I and -II. J Biol Chem. 271(48): 30322-5.
  • Wilson EM, et al. (1997) Generation and characterization of an IGFBP-7 antibody: identification of 31kD IGFBP-7 in human biological fluids and Hs578T human breast cancer conditioned media. J Clin Endocrinol Metab. 82(4): 1301-3.
  • Lin J, et al. (2007) Methylation patterns of IGFBP7 in colon cancer cell lines are associated with levels of gene expression. J Pathol. 212(1): 83-90.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait