Commande rapide

Text Size:AAA

Humain IkB alpha/NFKBIA expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human NFKBIA Informations sur les produits clonés de cDNA
Taille du ADNc:954bp
Description du ADNc:Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal His tag.
Synonyme du gène:IKBA, MAD-3, IkappaBalpha
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain IkB alpha/NFKBIA expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • Size / Price
    Catalogue : HG12045-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.