IL13RA1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

IL13RA1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1284 bp
Description
Full length Clone DNA of Human interleukin 13 receptor, alpha 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL13RA1 cDNA ORF Clone, Human, untagged: Alternative Names

CD213A1 cDNA ORF Clone, Human; IL-13Ra cDNA ORF Clone, Human; NR4 cDNA ORF Clone, Human

IL13RA1 Background Information

Interleukin 13 receptor, alpha 1, also known as IL13RA1/IL-13RA1 and CD213A1 (cluster of differentiation 213A1), is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. IL13RA1/IL-13RA1 serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. IL13RA1/IL-13RA1 binds with low affinity to interleukin-13 (IL13). This subunit together with IL4RA can form a functional receptor for IL13. IL13RA1/IL-13RA1 also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity.
Full Name
interleukin 13 receptor, alpha 1
References
  • Kawakami M, et al. (2002) Mutation and functional analysis of IL-13 receptors in human malignant glioma cells. Oncol Res. 12 (11-12): 459-67.
  • Umeshita-Suyama R, et al. (2000) Characterization of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of requirement of tyrosine residue for STAT3 activation. Int Immunol. 12 (11): 1499-509.
  • He JQ, et al. (2003) Polymorphisms in the IL13, IL13RA1, and IL4RA genes and rate of decline in lung function in smokers. Am J Respir. Cell Mol Biol. 28 (3): 379-85.

IL13RA1 cDNA ORF Clone, Cynomolgus, Related Products

IL13RA1 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait