Commande rapide

Humain IL13RA2 / CD213A2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human IL13RA2 Informations sur les produits clonés de cDNA
Taille du ADNc:1143bp
Description du ADNc:Full length Clone DNA of Homo sapiens interleukin 13 receptor, alpha 2 with C terminal Flag tag.
Synonyme du gène:IL-13R, IL13BP, CD213A2
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as also known as cluster of differentiation 213A2 (CD213A2), IL-13 receptor subunit alpha-2, IL-13R subunit alpha-2, and IL-13RA2. The IL13RA2 is often overexpressed in brain tumors, making Il13ra2 one of the vaccine targets for immunotherapy of glioma. IL13RA2/IL-13RA2 is a cancer-associated receptor that is present in greater than 80% of High Grade Astrocytomas (HGA) and has recently been recognized as a cytokine that predisposes breast cancer cells to metastasize. Expression of IL13Rα2 was rapidly lost from the surface of transduced cells grown in culture. The loss appeared to be related to ligands present in fetal bovine serum in the medium. None of the malignant glioma cell lines cultivated in vitro and tested to date exhibited the IL13Rα2 receptor. A recombinant virus (R5111) enters cells via its interaction with the IL13Rα2 receptor in a manner that cannot be differentiated from the interaction of wild-type virus with its receptors.

  • Zhou G, et al.. (2005) Characterization of a recombinant herpes simplex virus 1 designed to enter cells via the IL13Ralpha2 receptor of malignant glioma cells. J Virol. 79(9): 5272-7.
  • Osawa M, et al.. (2000) Characterization of the mouse interleukin-13 receptor alpha1 gene. Immunogenetics. 51(11): 974-81.
  • Nair BG, et al.. (2011) Nanotechnology platforms; an innovative approach to brain tumor therapy. Med Chem. 7(5): 488-503.
  • Benson M, et al.. (2006) A network-based analysis of the late-phase reaction of the skin. J Allergy Clin Immunol. 118(1): 220-5.
  • Size / Price
    Catalogue : HG10350-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.