IL-16 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

IL-16 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human interleukin 16 (lymphocyte chemoattractant factor).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-16 cDNA ORF Clone, Human, untagged: Alternative Names

LCF cDNA ORF Clone, Human; NIL16 cDNA ORF Clone, Human; prIL-16 cDNA ORF Clone, Human; PRIL16 cDNA ORF Clone, Human

IL-16 Background Information

Full Name
interleukin 16
References
  • Maciaszek JW, et al. (1997) IL-16 represses HIV-1 promoter activity. J Immunol. 158(1): 5-8.
  • Zhou P, et al. (1997) Human CD4+ cells transfected with IL-16 cDNA are resistant to HIV-1 infection: inhibition of mRNA expression. Nat Med. 3(6): 659-64.
  • Theodore AC, et al. (1996) CD4 ligand IL-16 inhibits the mixed lymphocyte reaction. J Immunol. 157(5): 1958-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait